View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7764_low_9 (Length: 264)
Name: NF7764_low_9
Description: NF7764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7764_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 12 - 261
Target Start/End: Complemental strand, 1330566 - 1330317
Alignment:
| Q |
12 |
atggacatcaactgggacttttgttacacctcaagttcgaagtttgcgcaagggcaatagcgattatgttgccattgctgttgatgaagaccctggtagt |
111 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330566 |
atggacaacaacggggacttttgttacacctcaagttcgaagtttgcgcaagggcaatagcgattatgttgccattgctgttgatgaagaccctggtagt |
1330467 |
T |
|
| Q |
112 |
acaagtaggatagaagacgaagatgatgacaagggtaattttgcactaattaatctgtgtgttggcttgtggtgctctcaaacactggttccttttatta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1330466 |
acaagtaggatagaagacgaagatgatgacaagggtaattttgcactaattaatctgtgtgttggcttgcggtgctctcaaacactggttccttttatta |
1330367 |
T |
|
| Q |
212 |
acttttagtttctccactttttcttgcagttcatggtttcatctcactcg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1330366 |
acttttagtttctccactttttcttgcagttcatggtttcaaatcactcg |
1330317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University