View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7765_high_38 (Length: 208)
Name: NF7765_high_38
Description: NF7765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7765_high_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 19 - 172
Target Start/End: Complemental strand, 31169336 - 31169184
Alignment:
| Q |
19 |
ttttgagtcacatcaaagattataaaagatatatttttctatggttattggaatacgctgtcaannnnnnnnnnnatgttcatatttttacgtaatttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31169336 |
ttttgagtcacatcaaagattataaaagatatatttttctatggttattggaatacgctgtcaatttttttttt-atgttcatatttttacgtaatttga |
31169238 |
T |
|
| Q |
119 |
acgatatttactaaagtaacttatattcgtcagactggatatatgtatgaattt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31169237 |
acgatatttactaaagtaacttatattcgtgagactggatatatgtatgaattt |
31169184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University