View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7765_low_22 (Length: 396)
Name: NF7765_low_22
Description: NF7765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7765_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 31402498 - 31402687
Alignment:
| Q |
15 |
atgaacaacagaaaatatttggaactcaattgcagagttttatgttttaagtaaaaagtttcaacccagtgtttaaaaatcttgaagattaattgccaat |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31402498 |
atgaacaacaaaaaatatttggaactcaattgcagagttttatgttttaagtaaaaagtttcaacccagtgtttaaaaatcttgaagattaattgccaat |
31402597 |
T |
 |
| Q |
115 |
gaagtcaagaaaatgcaatactatcatatattcaacgtgtggacttttcttgtcgaagcacttcttcaatgtcaagagtatatttgacttaaa |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31402598 |
gaagtcaagaaaatgcaa---tatcatatattcaacgtgtggacttttcttgtcgaagcacttcttcaatgtgaagagtatatttgacttaaa |
31402687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University