View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7765_low_50 (Length: 213)
Name: NF7765_low_50
Description: NF7765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7765_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 42516829 - 42516631
Alignment:
| Q |
1 |
cttgccgaataatctaagataacgatttatatctgcatcctctctctcacacctatccattgcaaccttaatacccttcaacaagccattacattcatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42516829 |
cttgccgaataatctaagataacgatttatatctgcatcctctctctcacacctatccattgcaaccttaatacccttcaacaagccattacattcatca |
42516730 |
T |
 |
| Q |
101 |
accatttcaaggtactcgagaacacgaccctgatgcgacttgttacaatccatatctttctccaatatctcttcaaaaccaaccttaatcaactccaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42516729 |
accatttcaaggtactcgagaacacgaccctgatgcgacttgttacaatccatatctttctccaatatctcttcaaaaccaaccttaatcaactccaaa |
42516631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University