View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7765_low_51 (Length: 208)

Name: NF7765_low_51
Description: NF7765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7765_low_51
NF7765_low_51
[»] chr2 (1 HSPs)
chr2 (19-172)||(31169184-31169336)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 19 - 172
Target Start/End: Complemental strand, 31169336 - 31169184
Alignment:
19 ttttgagtcacatcaaagattataaaagatatatttttctatggttattggaatacgctgtcaannnnnnnnnnnatgttcatatttttacgtaatttga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||    
31169336 ttttgagtcacatcaaagattataaaagatatatttttctatggttattggaatacgctgtcaatttttttttt-atgttcatatttttacgtaatttga 31169238  T
119 acgatatttactaaagtaacttatattcgtcagactggatatatgtatgaattt 172  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||    
31169237 acgatatttactaaagtaacttatattcgtgagactggatatatgtatgaattt 31169184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University