View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7765_low_52 (Length: 202)
Name: NF7765_low_52
Description: NF7765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7765_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 7560101 - 7560272
Alignment:
| Q |
16 |
atgaacacttgctgaaatttgagagagct---gaaaaccttacattcttcaaaacagatgtcttgaactatatttgaatttgtttactccgtcggatgca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7560101 |
atgaacacttgctgaaatttgagagagcttctgaaaaccttacattcttcaaaacagatgtcttgaaatatatttgaatttgtttactccgtcggatgca |
7560200 |
T |
|
| Q |
113 |
gtgtttagtatattgttaaaactactgaattgatagtgtttactttttatctctgctacgattaacacttat |
184 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7560201 |
gtgtttactatattgttaaaactactgaattgatagtgtttactttttatctctgctaagattaacacttat |
7560272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University