View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7766_high_4 (Length: 266)
Name: NF7766_high_4
Description: NF7766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7766_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 42 - 249
Target Start/End: Original strand, 49267259 - 49267466
Alignment:
| Q |
42 |
ccgttaggctcttgattttaagagcaactgttgtattatttgcactcgaaacagtcatttgggttcttgcttatgtcagggagtgtcattattgcctttg |
141 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49267259 |
ccgtttggctcttgattttaagagcaactgttgtattatttgcactcgaaacagtcatttgggttcttgcttatgtcagggagtgtcattattgcctttg |
49267358 |
T |
 |
| Q |
142 |
aatgtatcgaaatnnnnnnnnnnnnnnnnnnnntcctgaatgcgtcttttgctagtccgtttagttctcaaatgtgttttcgattcgttagttttgttgg |
241 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49267359 |
aatgtatcaaaataaataaaaaataaaaaaatatcctgaatgcgtcttttgctagtccgtttagttctcaaatgtgttttcgattcgttagttttgttgg |
49267458 |
T |
 |
| Q |
242 |
gttcaagt |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
49267459 |
gttcaagt |
49267466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University