View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7766_low_7 (Length: 252)
Name: NF7766_low_7
Description: NF7766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7766_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 3 - 239
Target Start/End: Complemental strand, 36522601 - 36522365
Alignment:
| Q |
3 |
atggaaattgtgaaacaaaaaatcagtgagcaaatatctcaaatttttaagatttattgcatcatatataaatagtgatgattctaatgggaaaaaaggt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36522601 |
atggaaattgtgaaacaaaaaatcagtgagcaaatatctcaaatttgtaagatttattgcatcatatgtaaatagtgatgattctaatgggaaaaaaggt |
36522502 |
T |
 |
| Q |
103 |
ccgcgattgcgatcttggccagcgatataatattcgatcgcaatatctagaattgtgacgcgatcgcaactgcaatttaaaaacatgaggttaggaaggt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522501 |
ccgcgattgcgatcttggccagcgatataatatttgatcgcaatatctagaattgtgacgcgatcgcaactgcaatttaaaaacatgaggttaggaaggt |
36522402 |
T |
 |
| Q |
203 |
gtttggtttggatgcaaaagttttatgggaggaatgt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522401 |
gtttggtttggatgcaaaagttttatgggaggaatgt |
36522365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University