View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7766_low_8 (Length: 244)
Name: NF7766_low_8
Description: NF7766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7766_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 33901911 - 33901688
Alignment:
| Q |
1 |
cacctgaaaaattgtaagtaacaagttagtttcctactcttgaaatggcaagttgagagaacaatggatgcatgcaattgccaatgttatttactcacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33901911 |
cacctgaaaaattgtaagtaacaagttagtttcctactgttgaaatggcaagttgagagaacaatggatgcatgcaattgccaatgttatttactcacct |
33901812 |
T |
 |
| Q |
101 |
tgtgtgcactttctaatgcttggccacctttgatcaacacaccttgagttgcaccaactccggtaccaaccatgaccgctgtaggagtggctaggcctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33901811 |
tgtgtgcactttctaatgcttggccacctttgatcaacacaccttgagttgcaccaactccggtaccaaccatgaccgctgtaggagtggctaggcctag |
33901712 |
T |
 |
| Q |
201 |
agcacaaggacaagctatgaccat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33901711 |
agcacaaggacaagctatgaccat |
33901688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 95 - 224
Target Start/End: Complemental strand, 33919339 - 33919212
Alignment:
| Q |
95 |
tcaccttgtgtgcactttctaatgcttggccacctttgatcaacacaccttgagttgcaccaactccggtaccaaccatgaccgctgtaggagtggctag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | || |
|
|
| T |
33919339 |
tcaccttgtgtgcactttctaatgcttggccacctttgatcaacacaccttgagttgcaccaactccagtaccaaccatgaccgctgtaggagtag--ag |
33919242 |
T |
 |
| Q |
195 |
gcctagagcacaaggacaagctatgaccat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33919241 |
gcctagagcacaaggacaagctatgaccat |
33919212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 97 - 224
Target Start/End: Original strand, 2780998 - 2781125
Alignment:
| Q |
97 |
accttgtgtgcactttctaatgcttggccacctttgatcaacacaccttgagttgcaccaactccggtaccaaccatgaccgctgtaggagtggctaggc |
196 |
Q |
| |
|
||||| ||||||||||| || ||||| || ||||||||||| ||||| |||| |||||||||||| || |||||||| || || ||||| ||||||| | |
|
|
| T |
2780998 |
accttatgtgcactttccaaagcttgcccccctttgatcaatacaccctgagatgcaccaactccagttccaaccataacagcggtaggtgtggctaaac |
2781097 |
T |
 |
| Q |
197 |
ctagagcacaaggacaagctatgaccat |
224 |
Q |
| |
|
| | ||||||||| ||||| || ||||| |
|
|
| T |
2781098 |
ccaaagcacaagggcaagcaataaccat |
2781125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University