View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_high_16 (Length: 317)
Name: NF7768_high_16
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 36261967 - 36262187
Alignment:
| Q |
12 |
tgttgctgggataaatattgttttggttagtgagatatgtaagaaagagaagggaaaggaatgagtgaaaaagtaacggaatatgatgagtaatatgtta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36261967 |
tgttgctgggataaatattgttttggttagtgagatatgtaagaaagagaagggaaag---------------taacggaatatgatgagtaatatgtta |
36262051 |
T |
|
| Q |
112 |
gaatatgcaaataagcaatgatgtgttgtttgtgctaacaatagttttcatgtttgatttgagcttgtggaattctgaaacctttattgaaaagtcttat |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36262052 |
gaatatgcaaataagcaatgatgtgtt---tgtgctaacaatagttttcatgtttgatttgagcttgtggaattctgaaacctttattgaaaagtcttat |
36262148 |
T |
|
| Q |
212 |
aataacagatttaaaaatatctgcttcaagagatccgga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36262149 |
aataacagatttaaaaatatctgcttcaagagatccgga |
36262187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 250 - 302
Target Start/End: Original strand, 36262212 - 36262264
Alignment:
| Q |
250 |
attatggaaaacagatttgaatggagctagttactactggagtctttgttatt |
302 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36262212 |
attatggaagacagatttgaatggagctagttactactggagtctttgttatt |
36262264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University