View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_high_27 (Length: 243)
Name: NF7768_high_27
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 14 - 136
Target Start/End: Complemental strand, 33829342 - 33829220
Alignment:
| Q |
14 |
agattatactcatctcaagcatatattcaacatgttaaaacatgtatttttcgagtttcatagtatttgagtcgagctttttcacgattaaaatttgaat |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33829342 |
agattatgctcatctcaagcatatattcaacaagttaaaacatgtatttttcgagtttcatagtatttgagtcgagctttttcacgattaaaatttgaat |
33829243 |
T |
 |
| Q |
114 |
gctaatatagttcatttcagaat |
136 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33829242 |
gctaatatagttcatttcagaat |
33829220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University