View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7768_high_31 (Length: 227)

Name: NF7768_high_31
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7768_high_31
NF7768_high_31
[»] chr5 (1 HSPs)
chr5 (13-208)||(37864441-37864636)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 37864441 - 37864636
Alignment:
13 ataatactgagattataacaaaatagtgtgggaattagaacaaactattcccctagcatgccgaagagattgatccaaactattccacaactagatagtg 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37864441 ataacactgagattataacaaaatagtgtgggaattagaacaaactattcccctagcatgccgaagagattgatccaaactattccacaactagatagtg 37864540  T
113 gaatttgaacagattgctattgtctccggatacgttacatagtattataaatgtaatcaaatagcccctatgacgacattatagcactgtcgagta 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37864541 gaatttgaacagattgctattgtctccggatacgttacatagtattataaatgtaatcaaatagcccctatgacgacattatagcactgtcgagta 37864636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University