View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_high_7 (Length: 421)
Name: NF7768_high_7
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 399
Target Start/End: Original strand, 53838513 - 53838909
Alignment:
| Q |
1 |
gttggattggtaatcactctttgtcctgcattgtatcttcttaattattaagctttaactttggttatagacttctgggtctaagagacaataacttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
53838513 |
gttggattggtaatcactctttgtcatgcattgtatcttcttatttattaagctttaactttggttatagacttctgggtctaaaaggcaataacttttt |
53838612 |
T |
 |
| Q |
101 |
cacattatgtacatagccagaagnnnnnnnntagtactaattgcaaaaaataattgtttgataaccattttcacacttcagtgcatctttgtatgcttcc |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53838613 |
cacattatgtacatagccagaa-aaaaaaaatagtactaattgcaaaaaataattgtttgataaccattttcacacttcagtgcatctttgtatgcttcc |
53838711 |
T |
 |
| Q |
201 |
tccacttgttagttgcagtgtcaagaaatttgattctcccttagaaatattattaatttcatatttgagttttgtgaatcaacttgactcaatttgataa |
300 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53838712 |
tccacttggtagttgcagtg-caagaaatttgattctcccttagaaatattattaatttcatatttgagttttgtgaatcaacttgactcaatttgataa |
53838810 |
T |
 |
| Q |
301 |
tgatagcctatagattgttgtattattagacaaattaaaactgcttctctgatttacatatgtcaatgtatgaaccaatcctatattgggcacgttggc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53838811 |
tgatagcctatagattgttgtattattagacaaattaaaactgcttccctgatttacatatgtcaatgtatgaaccaatcctatactgggcacgttggc |
53838909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University