View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_28 (Length: 306)
Name: NF7768_low_28
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 295
Target Start/End: Complemental strand, 34714965 - 34714674
Alignment:
| Q |
19 |
aattaagccttaattattttgattatggcttcggatttttctttatttttgatctaaaatgaatgatggtgatgatacaaacattgttgttgtagggaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34714965 |
aattaagccttaattattttgattatggcttcggatttttctttatttttgatcaaagatgaatggtggtgatgatacaaacattgttgttgtagggaat |
34714866 |
T |
 |
| Q |
119 |
agtcggt---------------ttacagcttttaataataaatactactagtacaattttaatttgttgtttacttttggcgtgattagtgattatagat |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34714865 |
agtcggtcgtacctttacaaatttacagcttttaataataaatactactagtacaattttaatttgttgtttacttttggcgtgattagtgattatagat |
34714766 |
T |
 |
| Q |
204 |
ttggttcatgtcgtttcatgttgtcggtggagtgagattttataggtggacggtggtgatcatgtgtttgaagtttgaaatgttcatttcat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34714765 |
ttggttcatgtcgtttcatgttgtcggtggagtgagattttataggtggacggtggtgatcatgtgtttgaagtttgaaatgttcatttcat |
34714674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University