View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_30 (Length: 294)
Name: NF7768_low_30
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 43458443 - 43458209
Alignment:
| Q |
1 |
gagtccaacaaagggaataacacaagtaaatataaaactaaataacttcaactatggtttaaagtttagctagaattatannnnnnnngtttgtttggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43458443 |
gagtccaacaaagggaataacacaagtaaatataaaactaaataacttcaactacggtttaaagtttagctagaattatatttttttcgtttgtttggta |
43458344 |
T |
 |
| Q |
101 |
cggctcatagtttactgataagtaggcaggtcgctcgagcagggcgagtatttaaacacaagttgtattgcagtcgaagacgtatgcacaatagaccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458343 |
cggctcatagtttactgataagtaggcaggtcgctcgagcagggcgagtatttaaacacaagttgtattgcagtcgaagacgtatgcacaatagaccaaa |
43458244 |
T |
 |
| Q |
201 |
ctctgtggtcaaatatcatgttttctctgtttacg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458243 |
ctctgtggtcaaatatcatgttttctctgtttacg |
43458209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 134
Target Start/End: Complemental strand, 4557178 - 4557146
Alignment:
| Q |
102 |
ggctcatagtttactgataagtaggcaggtcgc |
134 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
4557178 |
ggctcatagtttattgataagtaggcaggtcgc |
4557146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 136
Target Start/End: Complemental strand, 34372583 - 34372551
Alignment:
| Q |
104 |
ctcatagtttactgataagtaggcaggtcgctc |
136 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
34372583 |
ctcatagtttactgataagttggcaggtcgctc |
34372551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University