View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_33 (Length: 280)
Name: NF7768_low_33
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 4 - 261
Target Start/End: Original strand, 56492052 - 56492309
Alignment:
| Q |
4 |
aacaaaattgatatattaaaattaattggataaaagattgtcttttatatttaagactggagaaagtattagtttaggtgaatgtttttgaagaggatat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492052 |
aacaaaattgatatattaaaattaattggataaaagattgtcttttatatttaagcctggagaaagtattagtttaggtgaatgtttttgaagaggatat |
56492151 |
T |
 |
| Q |
104 |
tgaaagagaggaaattgggtagggtagtgacgtggctaaactgaagacaggagttgcaacttgaaaagaaacaacaacataatatttgatttggtgtttg |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492152 |
tgaaagaaaggaaattgggtagggtagtgacgtggctaaactgaagacaggagttgcaacttgaaaagaaacaacaacataatatttgatttggtgtttg |
56492251 |
T |
 |
| Q |
204 |
gtttccatgctatgccatgccatgaatgcgatgaggggtgtaagtgttggtgtgtttc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492252 |
gtttccatgctatgccatgccatgaatgcgatgaggggtgtaagtgttggtgtgtttc |
56492309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University