View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_37 (Length: 264)
Name: NF7768_low_37
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 245
Target Start/End: Original strand, 14122161 - 14122397
Alignment:
| Q |
7 |
ctgaaatgaaaagaatatgtatttggnnnnnnnntaatatacaacatcctgggggataaaaacccaaaaatcatgcagaaagtcaaatgttacaaaagtt |
106 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14122161 |
ctgaagtgaaaagaatatgtatttggaaaaaaa-taatatacaacatcctgggggataaaaaaccaaaa-tcatgcagaaagtcaaatgttacaaaagtt |
14122258 |
T |
|
| Q |
107 |
gtattcaacctcgtgtgatttttctaaaatttatatctaatcggtgtgaagtcagaaacacgttttccttcaaaatctgtgttatcacttgaaattgtga |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14122259 |
gtattcaacctcgtgtgatatttctaaaatttatatctaatcggtgtgaagtcagaaacacgttttccttcaaaatctgtgttatcacttgaagttgtga |
14122358 |
T |
|
| Q |
207 |
tacaaaagtcttcaatttcatcaccctagtgtttggtca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14122359 |
tacaaaagtcttcaatttcatcaccctagtgtttggtca |
14122397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University