View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_38 (Length: 262)
Name: NF7768_low_38
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 29 - 248
Target Start/End: Original strand, 3683235 - 3683460
Alignment:
| Q |
29 |
gtttacggtcgcgattgcatttgattgaaaattctaatatcaaagattcagacgcgaccgtgatca------cgaattcatattaaccttggtggcaaaa |
122 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
3683235 |
gtttacggtcgcgattgtatttaattaaaaattctaatattaaagattcagacgcgaccgtgatcgtgatcccgaatttatattaaccttggtggcaaaa |
3683334 |
T |
|
| Q |
123 |
atcatatgtagaataatgtctttcggtggtatcaataaaccacatataaacctcgtcatggtggctgttggcaaacacaagaatagtggtcatgcctttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683335 |
atcatatgtagaataatgtctttcggtggtatcaataaaccacatataaacctcgtcatggtggctgttggcaaacacaagaatagtggtcatgcctttc |
3683434 |
T |
|
| Q |
223 |
gttggacaacaaataatattgataat |
248 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
3683435 |
gttggacgacaaataatattgataat |
3683460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University