View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_39 (Length: 256)
Name: NF7768_low_39
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 7598533 - 7598304
Alignment:
| Q |
1 |
ttttgcactagtgattgacttccaccatgcacctaagaatttgaaggnnnnnnnngaagttccaagtcaaaaactcgagaaatatgagnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7598533 |
ttttgcactagtgattgacttccaccatgcacctaagaatttgaagggaaaaaaa-aagttccaagtcaaaaactcgagaaatatgagtttttctttttt |
7598435 |
T |
|
| Q |
101 |
cataaagtgatcattacatataacccaaaagtattgcttttgaagaaacttactcgtaagccatagattaattatggacaatttaactggtgcgatgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
7598434 |
cataaagtgatcattacatataacccaaaagtattgcttttgaagaaacttactcttaagccatagactaattatggacaatttaactcgtgtgatgata |
7598335 |
T |
|
| Q |
201 |
tataatcttacgttattttcaacatattttt |
231 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
7598334 |
tataatcttacgttattttcagcatattttt |
7598304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University