View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_49 (Length: 241)
Name: NF7768_low_49
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5295016 - 5294794
Alignment:
| Q |
1 |
atcacgttgatgactatgtgtggatcccacaccttcggagacagttacagcagaagcaccaccaccaacaacaccttcatagtgacaacgtttgtgtcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5295016 |
atcacgttgatgactatgtgtggatcccataccttcagagacagttacagcagaagcaccaccaccaacaacaccttcatagtgacaacgtttgtgtcca |
5294917 |
T |
|
| Q |
101 |
cccaaagcttgtcctgtcggaaacgacctatgacaaatcgaacactcatgagatctaacaccaccaccgtttgtgttggctgagcttgtggtagcagctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5294916 |
cccaaagcttgtcctgtcggaaacgacctatgacaaatcgaacactcatgagatctaacaccaccaccgtttgtgttggctgagcttgtggtagcagctg |
5294817 |
T |
|
| Q |
201 |
aggaagttgatggatgatcatca |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5294816 |
aggaagttgatggatgatcatca |
5294794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 152
Target Start/End: Original strand, 47435854 - 47435932
Alignment:
| Q |
74 |
ccttcatagtgacaacgtttgtgtccacccaaagcttgtcctgtcggaaacgacctatgacaaatcgaacactcatgag |
152 |
Q |
| |
|
||||| ||||||||||| |||||||| |||||||| ||||| || ||||| || | ||||| || ||||||||||||| |
|
|
| T |
47435854 |
ccttcgtagtgacaacgcttgtgtcctcccaaagcctgtccagtaggaaaggatttgtgacagatggaacactcatgag |
47435932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University