View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_52 (Length: 238)
Name: NF7768_low_52
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 95 - 221
Target Start/End: Original strand, 33610054 - 33610178
Alignment:
| Q |
95 |
ctccccagacttaaatcagacattgtcttcaattaatattacaaatataatttgaagcatacactatatagtttggacaaaaaagatagaatagcgaaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
33610054 |
ctccccagacttaaatcagacattgtcttcaattaatattacaaatataatttgaagcatacac--tatagtttggacaataaagatagactagcgaaat |
33610151 |
T |
|
| Q |
195 |
ttacccgaaatttaagtggcctttgtg |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33610152 |
ctacccgaaatttaagtggcctttgtg |
33610178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University