View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7768_low_52 (Length: 238)

Name: NF7768_low_52
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7768_low_52
NF7768_low_52
[»] chr2 (1 HSPs)
chr2 (95-221)||(33610054-33610178)


Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 95 - 221
Target Start/End: Original strand, 33610054 - 33610178
Alignment:
95 ctccccagacttaaatcagacattgtcttcaattaatattacaaatataatttgaagcatacactatatagtttggacaaaaaagatagaatagcgaaat 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||| ||||||||| |||||||||    
33610054 ctccccagacttaaatcagacattgtcttcaattaatattacaaatataatttgaagcatacac--tatagtttggacaataaagatagactagcgaaat 33610151  T
195 ttacccgaaatttaagtggcctttgtg 221  Q
     ||||||||||||||||||||||||||    
33610152 ctacccgaaatttaagtggcctttgtg 33610178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University