View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_55 (Length: 227)
Name: NF7768_low_55
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 37864441 - 37864636
Alignment:
| Q |
13 |
ataatactgagattataacaaaatagtgtgggaattagaacaaactattcccctagcatgccgaagagattgatccaaactattccacaactagatagtg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37864441 |
ataacactgagattataacaaaatagtgtgggaattagaacaaactattcccctagcatgccgaagagattgatccaaactattccacaactagatagtg |
37864540 |
T |
|
| Q |
113 |
gaatttgaacagattgctattgtctccggatacgttacatagtattataaatgtaatcaaatagcccctatgacgacattatagcactgtcgagta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37864541 |
gaatttgaacagattgctattgtctccggatacgttacatagtattataaatgtaatcaaatagcccctatgacgacattatagcactgtcgagta |
37864636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University