View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7768_low_57 (Length: 222)
Name: NF7768_low_57
Description: NF7768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7768_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 28 - 209
Target Start/End: Complemental strand, 10837806 - 10837625
Alignment:
| Q |
28 |
cctgaaacataaaattcaaagctaagtcaacttcactataatactgaaaaattctctagatattgcaactctgaaaattatttgtttcagctacatgttt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10837806 |
cctgaaacataaaattcaaagctaagtcaacttcactataatactgtaaaattctctagatattgcaactctgaaaattatttgtttcagctacatgttt |
10837707 |
T |
 |
| Q |
128 |
tcttataatacaactaagactatagagatacttgtgtcatgagtcatgacgtaattgagatccatttaagatatccgcttct |
209 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10837706 |
tcttataatacttctaagactatagagatactcgtctcatgagtcatgacgtaattgagatccatttaagatatccgcttct |
10837625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University