View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7769_high_11 (Length: 218)
Name: NF7769_high_11
Description: NF7769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7769_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 45768650 - 45768840
Alignment:
| Q |
18 |
attaggagatggatatttgaactcttagtctgcctaatccagtgattgagtttggcattcctgataaactatgttttataattacatgtaggaaactgat |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
45768650 |
attaggagatggatgtttgaactcttagtctgcctaatccagtgattgagtttggcattcctaataagccatgttttataattacatgtagaaaactgat |
45768749 |
T |
 |
| Q |
118 |
cgaaaataccattattctcctgcttctcttacgaaaatatggcagtagaaccgaaagatgtttagcaaacatccatattcttgtatgatgt |
208 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
45768750 |
cgaaaataccattagcctcctatttctcttacgaaaatgtggcagtagaaccaaaagatttttagcaaacatccatattcttatatgatgt |
45768840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University