View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7769_low_30 (Length: 257)
Name: NF7769_low_30
Description: NF7769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7769_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 10117652 - 10117399
Alignment:
| Q |
1 |
ggccatttaaaccggcgaat-gaatccttgttgcttctaaaccctatttgcttccaaccctagctgttagttaccgtcactc--------cgtgcaaaaa |
91 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10117652 |
ggccatttaaaccggcgaatagaatccttgttgcttctaaaccctatttgcttctaaccctagctgttagttaccgtcactcactgttgccgtgcaaaaa |
10117553 |
T |
|
| Q |
92 |
caacgtgcacaaaagaatgtctgagcccgaaatttctaagtcggcagcggataggatcagcagtttacccgac---atactgattcacatcctctcttgc |
188 |
Q |
| |
|
||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10117552 |
caa---------aagaatgtctgagcccgaaatttcgacatcggcagcggataggatcagcagtttacccgacgatatactgattcacatcctctcttgc |
10117462 |
T |
|
| Q |
189 |
gatggttctagaaaaatgtccaatccttgaagatcttcaactatctgatatacacaggttctg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10117461 |
gatggttctagaaaaatgtccaatccttgaagatcttcaactatctgatatacacagtttctg |
10117399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 61
Target Start/End: Complemental strand, 1446917 - 1446877
Alignment:
| Q |
21 |
gaatccttgttgcttctaaaccctatttgcttccaacccta |
61 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
1446917 |
gaatcgttgatgcttctaaaccctattagcttccaacccta |
1446877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University