View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7769_low_34 (Length: 236)
Name: NF7769_low_34
Description: NF7769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7769_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 46210300 - 46210517
Alignment:
| Q |
1 |
cattctttgggttgtgtgcaaacggaggaacttgaagctttggcaacaaagtgatggaactaatatgcaggccatagagtgtgcaacgcacttgatggaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46210300 |
cattctttggattgtgtgcaaacggaggaacttgaagctttggcaacaaagtgatggaactaatatgcaggccatagagtgtgcaacgcacttgatggaa |
46210399 |
T |
|
| Q |
101 |
gaatggagacttgcataaaatatttgctcaagcagtgcaacccgatccaactccgagatgtgaggaatgagtggtgcagctgagcaccattgtgtaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46210400 |
gaatggagacttgcataaaatattcgctcaagcagtgcaaccctatccaacaccgagaagtgaggaatgagtagtgcagctgagcaccattgtgtaaaat |
46210499 |
T |
|
| Q |
201 |
ctgctcctagcaggtata |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46210500 |
ctgctcctagcaggtata |
46210517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University