View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7769_low_35 (Length: 224)
Name: NF7769_low_35
Description: NF7769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7769_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 3165050 - 3165255
Alignment:
| Q |
1 |
cagcctcgaggtcttcaatctttgatttaagagacctgaaacatacaagtaaccacacttttatataattttaacaagaatgtgttgaattataccgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3165050 |
cagcctcgaggtcttcaatctttgatttaagagacctgaaacatacaagtaaccacacttttatataattttaacaagaatgtgttgaattatacggttc |
3165149 |
T |
 |
| Q |
101 |
atcaaatgataaaatattatcatgtttatgtcattttctactcttattcaactctcttatcctatcgtgatgaaacagacccaaaatgtccatacagcgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3165150 |
atcaaatgataaaatattatcatgtttatgtcattttctactcctattcaactctcttaacctatcgtgatgaaacagacccaaaatgtccatacagcgc |
3165249 |
T |
 |
| Q |
201 |
acgcta |
206 |
Q |
| |
|
|||||| |
|
|
| T |
3165250 |
acgcta |
3165255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 22844296 - 22844356
Alignment:
| Q |
1 |
cagcctcgaggtcttcaatctttgatttaagagacctgaaacatacaagtaaccacacttt |
61 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
22844296 |
cagccttgaggtcttcaatctttgatttaaaagacctgaaacatacaagtaaccacgcttt |
22844356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University