View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7770_high_3 (Length: 330)
Name: NF7770_high_3
Description: NF7770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7770_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 148 - 326
Target Start/End: Complemental strand, 31851745 - 31851577
Alignment:
| Q |
148 |
tttggtccttataaatgtttggtacatcctatgactatcatatgttggtgctcttttgtctagggatctacgtctactatttactacaacacaaatgcag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31851745 |
tttggtccttataaatgtttggtacatcctatgactatcat----------tcttttgtctagggatctatgtctactatttactacaacacaaatgcaa |
31851656 |
T |
|
| Q |
248 |
acaaaatagcactagtaattgatggtgaaggagaatttgagatggcatgtccacacatgtcatcaagttcatctcactc |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31851655 |
acaaaatagcactagtaattgatggtgaaggagaatttgagatggcatgtccacacatgtcatcaagttcatcacactc |
31851577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 31852285 - 31852176
Alignment:
| Q |
19 |
atttggtagtctctttgaagttggtccttcagaaattacaagtggacttgatggactcaatctcatgcttacctttgccaacatcaccaaggtatatatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31852285 |
atttggtagtctctttgaagttggtccttcagaaattacaagtggacttgatggactcaatctcatgcttacctttgccaacatcaccaaggtatatatc |
31852186 |
T |
|
| Q |
119 |
taatatataa |
128 |
Q |
| |
|
|||||||||| |
|
|
| T |
31852185 |
taatatataa |
31852176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University