View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7770_high_6 (Length: 258)
Name: NF7770_high_6
Description: NF7770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7770_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 39272680 - 39272905
Alignment:
| Q |
16 |
atgaatttacacgttcagtagtggcaatatcagtctctgccacagctggtggtgttatagcctcctctagcacagttttgaatgctacatgacccttctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39272680 |
atgaatttacacgttcagtagtggcaatatcagtctctgctacagctggtggtgttataggctcctctagcacagttttgaatgctacatgacccttctt |
39272779 |
T |
 |
| Q |
116 |
atgatttcgtggacgatcatagcgtttccgaagcataggctcagttacttcatggacttggtaattgtaggagttggaaggacaccaaccgcgatatatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39272780 |
atgatttcgtggacgatcatagcgtttccgaagcataggctcagttacttcatggacttggtaattgtaggagttggaaggacaccaaccgcgatatatg |
39272879 |
T |
 |
| Q |
216 |
atgttttgtttttccatttcctatat |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39272880 |
atgttttgtttttccatttcctatat |
39272905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University