View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7770_low_14 (Length: 258)
Name: NF7770_low_14
Description: NF7770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7770_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 51822056 - 51822296
Alignment:
| Q |
1 |
caattgataccaacgacgttgctttagaaatctcttccggtatttcaccggttaaccggttactccttgcgaatatactagcaagtttattcgccttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51822056 |
caattgataccaacgacgttgctttagaaatctcttccggtatttcacccgttaaccggttactccttgcgaatatactagcaagtttattcgctttttg |
51822155 |
T |
|
| Q |
101 |
aatctctgaacttacggaaccttctaactgattcaattcaacatcaattacttgaacattgggtaatccccaaataccggaaggaacggtacctgagagc |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822156 |
aatctctgaactaacggaaccttctaactgattcaattcaacatcaattacttgaacattgggtaatccccaaataccggaaggaacggtacctgagagc |
51822255 |
T |
|
| Q |
201 |
gagtttctactcactctgaatcgttctaaactcaaacaggt |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51822256 |
gagtttctactcactctgaggcgttctaaactcaaacaggt |
51822296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University