View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7770_low_14 (Length: 258)

Name: NF7770_low_14
Description: NF7770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7770_low_14
NF7770_low_14
[»] chr3 (1 HSPs)
chr3 (1-241)||(51822056-51822296)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 51822056 - 51822296
Alignment:
1 caattgataccaacgacgttgctttagaaatctcttccggtatttcaccggttaaccggttactccttgcgaatatactagcaagtttattcgccttttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||    
51822056 caattgataccaacgacgttgctttagaaatctcttccggtatttcacccgttaaccggttactccttgcgaatatactagcaagtttattcgctttttg 51822155  T
101 aatctctgaacttacggaaccttctaactgattcaattcaacatcaattacttgaacattgggtaatccccaaataccggaaggaacggtacctgagagc 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51822156 aatctctgaactaacggaaccttctaactgattcaattcaacatcaattacttgaacattgggtaatccccaaataccggaaggaacggtacctgagagc 51822255  T
201 gagtttctactcactctgaatcgttctaaactcaaacaggt 241  Q
    |||||||||||||||||||  ||||||||||||||||||||    
51822256 gagtttctactcactctgaggcgttctaaactcaaacaggt 51822296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University