View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7770_low_8 (Length: 343)
Name: NF7770_low_8
Description: NF7770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7770_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 19097271 - 19096929
Alignment:
| Q |
1 |
tcatgagctccatcaaatatggcaactgccaatgcttacctctataaattctcatctaaaaattttaagcctcttatgatgattatgtaattgggatcaa |
100 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097271 |
tcatgtgctccatcaaatatggaaactgccaatgcttacctctataaattctcatctaaaaattttaagcctcttatgatgattatgtaattgggatcaa |
19097172 |
T |
 |
| Q |
101 |
cagaggattaccagccggtggacccctttgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaatgtta |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097171 |
cagagaattaccagccggtggacccctttgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaatgtta |
19097072 |
T |
 |
| Q |
201 |
ttgagttgctgcgtcaacggagtgctgctttcattggtgacaacaggtggtgaggaagaaggggtaacctgtgtttgccgcctcggcctcccccttcccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097071 |
ttgagttgctgcgtcaacggagtgctgctttcattggtgacaacaggtggtgaggaagaaggggtaacctgtgtttgccgcctcggcctcccccttcccc |
19096972 |
T |
 |
| Q |
301 |
tcccactaccgttcctagtcgagcttcttctagttaatcctga |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19096971 |
tcccactaccgttcctagtcgagcttcttctagttaatcctga |
19096929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 129 - 195
Target Start/End: Complemental strand, 32149164 - 32149098
Alignment:
| Q |
129 |
tgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaa |
195 |
Q |
| |
|
||||| || ||||||| ||||| || ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32149164 |
tgtctacggggccttcttgttgtctttccccaacctgttaggcttctatcctccaaacccacttcaa |
32149098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University