View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7771_low_13 (Length: 310)
Name: NF7771_low_13
Description: NF7771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7771_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 24497238 - 24497117
Alignment:
| Q |
1 |
aagatgccctcttatgtgtattatgcttttaaatttgttattagaacatgtaattgttctttaaaatgcttatttagattgttcctttgtaagtttcaat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24497238 |
aagaagccctcttatgtgtattatgcttttaactttgttattagaacatgtaattgttctttaaaatgcttatttagattgttcctttgtaagtttcaac |
24497139 |
T |
|
| Q |
101 |
aagatttgaatctaatgaagta |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24497138 |
aagatttgaatctaatgaagta |
24497117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 44 - 119
Target Start/End: Original strand, 24982285 - 24982360
Alignment:
| Q |
44 |
gaacatgtaattgttctttaaaatgcttatttagattgttcctttgtaagtttcaataagatttgaatctaatgaa |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24982285 |
gaacatgtgattgttctttaaaatgcttatttggattgttcctttgtaagtttcaacaagatttgaatctaatgaa |
24982360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University