View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7771_low_19 (Length: 240)
Name: NF7771_low_19
Description: NF7771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7771_low_19 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 119 - 240
Target Start/End: Complemental strand, 42069883 - 42069758
Alignment:
| Q |
119 |
acacatagtacaatagggttttgtagtata----atttaaaattacagaagtacttgtcatgccaaaataaatacaagtccccataggtatggagtattt |
214 |
Q |
| |
|
||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42069883 |
acacataatacaataggattttgtagtatatataatttaaaattacagaagtacttgtcatgccaaaataaatacaagtccccataggtatggagtattt |
42069784 |
T |
 |
| Q |
215 |
ttgaacttggagagaacaatattttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42069783 |
ttgaacttggagagaacaatattttt |
42069758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 52
Target Start/End: Complemental strand, 42069912 - 42069881
Alignment:
| Q |
21 |
aacgagtcatcatttttataataattttgaca |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42069912 |
aacgagtcatcatttttataataattttgaca |
42069881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University