View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7771_low_22 (Length: 219)
Name: NF7771_low_22
Description: NF7771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7771_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 83 - 201
Target Start/End: Complemental strand, 44965850 - 44965732
Alignment:
| Q |
83 |
ccaattttgaaacaaattttacctctggaattgaaggatctcttgcaatgaagaatagcactttgaattccatcatgctgctgcaacagcgtatcatcac |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44965850 |
ccaattttgaaacaaattttacctctggaattgaaggatctcttgcaatgaagaatagcactttgaattccatcatgctgctgcaacaacgtatcatcac |
44965751 |
T |
 |
| Q |
183 |
tcctgttcgccggagaact |
201 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44965750 |
tcctgttcgccggagaact |
44965732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 112 - 182
Target Start/End: Complemental strand, 2502611 - 2502541
Alignment:
| Q |
112 |
attgaaggatctcttgcaatgaagaatagcactttgaattccatcatgctgctgcaacagcgtatcatcac |
182 |
Q |
| |
|
|||||||||||||||||| || | ||| || | |||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
2502611 |
attgaaggatctcttgcagtgtaaaatggctccttgaattccatcttgctgctgcaaaagcgaatcatcac |
2502541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University