View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7771_low_23 (Length: 213)
Name: NF7771_low_23
Description: NF7771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7771_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 25 - 213
Target Start/End: Complemental strand, 46602777 - 46602591
Alignment:
| Q |
25 |
gagtggttgaaacaatgggatacatgcaaaagacactacgatacacaagtaatcatttataaaagtaaatatgtgaatttagggatagaacccataaaca |
124 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46602777 |
gagtggttgaaacaacgggatacatgcaaaagacactacgatacacaagtaattaattataaaagtaaatatgtgaatttagggatagaacccataaata |
46602678 |
T |
 |
| Q |
125 |
atataagagagagaaccatgaacctattgagtttcaaatgtaagtggttaagttccccgtcgaatagaaatgaaagaaatgtttgatat |
213 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
46602677 |
atataaga--gagaaccatgaacctactgagtttcaaatgtaagtggttaagttccacgtcgaatagaaatgaaaaaaatatttgatat |
46602591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University