View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7773_high_2 (Length: 327)
Name: NF7773_high_2
Description: NF7773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7773_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 34136812 - 34137127
Alignment:
| Q |
1 |
ggcaacatattaccgaggaactcatgctgtaattgcagtgattgacagcagtgatagagctaggatctctttaatgaaggatgaacttttcaggttgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34136812 |
ggcaacatattaccgaggaactcatgctgtaattgcagtgattgacagcagtgatagagctaggatctctttaatgaaggatgaacttttcaggttgctg |
34136911 |
T |
|
| Q |
101 |
ggtcatgaagatttacaacattcagtcatccttgtctttgctaataaacaagatatcaaggatgctatgactcctgctgaaatcactgatgctctgtcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34136912 |
ggtcatgaagatttacaacattcagtcatccttgtctttgctaataaacaagatatcaaggatgctatgactcctgctgaaatcactgatgctctgtcac |
34137011 |
T |
|
| Q |
201 |
ttcacagcatcaaggatcatgattggcatatacaagcttgcagtgccatctcaggagacggcctttatgatggtcttggatggattgccgggcgagtaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34137012 |
ttcacagcatcaaggatcatgattggcatatacaagcttgcagtgccatctcaggagacggcctttatgatggtcttggatggattgccgggcgagtaac |
34137111 |
T |
|
| Q |
301 |
tggcaaagcatgatgt |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34137112 |
tggcaaagcatgatgt |
34137127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 237
Target Start/End: Complemental strand, 34150785 - 34150709
Alignment:
| Q |
161 |
gatgctatgactcctgctgaaatcactgatgctctgtcacttcacagcatcaaggatcatgattggcatatacaagc |
237 |
Q |
| |
|
|||||||| ||||||||||| || |||||||| |||| ||| |||||||||| |||||||| |||||| ||||||| |
|
|
| T |
34150785 |
gatgctattactcctgctgagattactgatgcagtgtctctttacagcatcaatgatcatgaatggcatttacaagc |
34150709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University