View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7773_high_4 (Length: 294)
Name: NF7773_high_4
Description: NF7773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7773_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 2 - 285
Target Start/End: Complemental strand, 39257048 - 39256766
Alignment:
| Q |
2 |
cacatctacactcaaaactagggggtgtttgcgaatcagttcggatcgattttgcggcaaaaagtcatttgatccaaaaacatccaataagattcacnnn |
101 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39257048 |
cacatctacactcaaaactagggg-tgtttgcgaatcagttcggatcgattttgcggcaaaaagtcatttgatccaaaaacatccaataagattcacttt |
39256950 |
T |
|
| Q |
102 |
nnnn-cagtttgcagtatttttggaccacatttggatgtgaacacccttacccaaaaccttaaaacattgggtatatgggtccctcgcttatatgttgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39256949 |
tttttcagtttgcagtatttttggaccacatttggatgtgaacacccctacccaaaacattaaaacattgggtatatgggtccctcgcttatatgttgct |
39256850 |
T |
|
| Q |
201 |
caacaccctcatttcatccaatgtaaaaaattcttactctcatttgacaccctaacaggagggaaggtctttcatgtgatgtcca |
285 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39256849 |
caacaccctcatttcatccaatgta-aaaattcttactctcatttgacaccctaacaggagggaaggtctttcatgtgatgtcca |
39256766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 80
Target Start/End: Complemental strand, 5987735 - 5987679
Alignment:
| Q |
24 |
gggtgtttgcgaatcagttcggatcgattttgcggcaaaaagtcatttgatccaaaa |
80 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| || |||| |||||||||||||||| |
|
|
| T |
5987735 |
gggtgtttgcgatacagtttggatcgattttaaggtaaaatgtcatttgatccaaaa |
5987679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 206
Target Start/End: Complemental strand, 27603821 - 27603765
Alignment:
| Q |
151 |
cccaaaaccttaaaacattgggtatatgggtccc-tcgcttatatgttgctcaacac |
206 |
Q |
| |
|
||||||||||||| ||||| | ||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
27603821 |
cccaaaaccttaacacattagatatatggatcccctcgcttctatgttgctcaacac |
27603765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 182
Target Start/End: Original strand, 21396172 - 21396204
Alignment:
| Q |
150 |
acccaaaaccttaaaacattgggtatatgggtc |
182 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
21396172 |
acccaaaaccttaagacattgggtatatgggtc |
21396204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University