View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7773_low_12 (Length: 267)
Name: NF7773_low_12
Description: NF7773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7773_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 4032760 - 4032998
Alignment:
| Q |
13 |
tggacatcattcggaatatcaccagagaaagaattatcggagaggtcgagattctggagtcgtggaacggtgcagacagaagccggaaacggaccggaga |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032760 |
tggatatcattcggaatatcaccagagaaagaattatcggagaggtcgagattctggagtcgtggaacggtgcagacagaagccggaaacggaccggaga |
4032859 |
T |
|
| Q |
113 |
gattattccggtgaagaaaaatactatgaagtgcagtagcattaaacaactgaaccggaacaacaccatagaattcattatcatgaagattaagacgtcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032860 |
gattattccggtgaagaaaaatactatgaagtgcagtagcattaaacaactgaaccggaacaacaccatagaattcattatcatgaagattaagacgtcg |
4032959 |
T |
|
| Q |
213 |
aagatagcgaagcatgccgagctcagacggaatgtatcc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032960 |
aagatagcgaagcatgccgagctcagacggaatgtatcc |
4032998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University