View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7773_low_15 (Length: 219)
Name: NF7773_low_15
Description: NF7773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7773_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 77 - 208
Target Start/End: Original strand, 42540769 - 42540896
Alignment:
| Q |
77 |
ttatacctaccaataccaataggaatgaaaatgaaaatgaaaatgtgttggaatagggtttttgaagtgtgatttagttagtatattggtgtcgatggaa |
176 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42540769 |
ttatacctaccaataccaataggaa----aatgaaaatgaaaatgtgttggaatagggtttttgaagtgtgatttagttagtatattggtgtcgatggaa |
42540864 |
T |
|
| Q |
177 |
acgaggttgagggtgtgactgtgtctatgcta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42540865 |
acgaggttgagggtgtgactgtgtctatgcta |
42540896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University