View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7774_low_11 (Length: 265)
Name: NF7774_low_11
Description: NF7774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7774_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 17431629 - 17431871
Alignment:
| Q |
8 |
cgaataatatctgttgccatagtaaattttgtctgcaattctgttgtagctgttagattcagtccacaatcataagttaaaactatagttaaatcagtga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17431629 |
cgaataatatctgttgccatagtaaattttgtctgcaattctgttgtagctgttagattcagtccacaatcataagttaaaactatagttaaatcagtga |
17431728 |
T |
|
| Q |
108 |
taaagtttcgcttttacctaatttgtcacccctg-cttgtttttggagaagttctggcatttcgatgctctggtaaaatgataaaaatactttgtcggtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17431729 |
taaagtttcgcttttacctaatttgtcacccctgccttgtttttggagaagtgctggcatttcgatgctctggtaaaatgataaaaatactttgtcggtt |
17431828 |
T |
|
| Q |
207 |
ttctgctagtttgtaacggcgttgtggtgtttaaggctgttca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17431829 |
ttctgctagtttgtaacggcgttgtggtgttcaaggctgttca |
17431871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 121
Target Start/End: Original strand, 17430586 - 17430676
Alignment:
| Q |
30 |
taaattttgtctgcaattctgttgtagctgttagattcagtccacaatcataagttaaaactatagttaaatcagtgataaagtttcgcttt |
121 |
Q |
| |
|
||||||| | |||||||| || | |||||||||||| | ||||||||| |||| || |||| | ||||||||||||||| |||||| ||||| |
|
|
| T |
17430586 |
taaatttcggctgcaattgtggtctagctgttagatgctgtccacaattataactt-aaaccacagttaaatcagtgatgaagttttgcttt |
17430676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University