View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7776_low_11 (Length: 281)
Name: NF7776_low_11
Description: NF7776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7776_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 263
Target Start/End: Complemental strand, 5654886 - 5654631
Alignment:
| Q |
8 |
ttcgtgtttgtgtcaatatttcataggctctggcattcgcatttgaaattatgtctagacaccaaaacatgtatacactcannnnnnngcttcttgataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
5654886 |
ttcgtgtttgtgtcaatatttcataggctccggcattcgcatttgaaattatgtctagacaccaaaacatgtatacactcatttttttgctgcttgataa |
5654787 |
T |
|
| Q |
108 |
aaaatgagcatgtctttgctgcacaattgtcaattatcattgaagtcaatgatctcgaccgttgatgaagattggaacggctaatatttgatgttatgga |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5654786 |
aaaatgagcatgtctttgctgcacaatcatcaattatcattgaagtcaatgatctcgaccgttgatgaagattggaacggcgaatatttgatgttatgga |
5654687 |
T |
|
| Q |
208 |
tttgtcgagttacaatttgagtcatctgatctttatccaattgattaaattgtcta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5654686 |
tttgtcgagttacaatttgagtcatctgatctttatccaattgattaaattgtcta |
5654631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University