View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7776_low_15 (Length: 247)
Name: NF7776_low_15
Description: NF7776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7776_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 53297398 - 53297192
Alignment:
| Q |
1 |
acactttcggttggatgataactgtcccaaaatatgtattctgaattatcaggacaagtggcactcaatgggttgcatagcactgaaacctctagctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53297398 |
acactttcggttggatgataactgtcccaaaatatgtattctgaattatcaggacaagtggcactcaatgggttgcatagcactgaaacctctagctttc |
53297299 |
T |
 |
| Q |
101 |
ctgtaccacaacaacctttatccgcaactttatatcctgcatgca-ttaatgaagttaggaattaactaactaacttattaa-ttaatcatcaatgatta |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
53297298 |
ctgtgccacaacaacctttatccgcaactttatatcctgcatgcatttaatgaagttaggaattaactaactacttaattaatttaatcatcaatgatta |
53297199 |
T |
 |
| Q |
199 |
gatttta |
205 |
Q |
| |
|
||||||| |
|
|
| T |
53297198 |
gatttta |
53297192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 8290364 - 8290246
Alignment:
| Q |
13 |
ggatgataactgtcccaaaatatgtattctgaattatcaggacaagtggcactcaatgggttgcatagcactgaaacctctagctttcctgtaccacaac |
112 |
Q |
| |
|
||||||||||| |||||||| | ||||||||| ||||| |||||| ||| || |||||||||| ||||| ||||||||| || ||||| ||||||| |
|
|
| T |
8290364 |
ggatgataactatcccaaaagacatattctgaagcatcagaacaagtagcatctaaagggttgcataacactgcaacctctagtttccctgtgccacaac |
8290265 |
T |
 |
| Q |
113 |
aacctttatccgcaacttt |
131 |
Q |
| |
|
||||| | ||| ||||||| |
|
|
| T |
8290264 |
aacctctgtccacaacttt |
8290246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University