View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7776_low_20 (Length: 219)
Name: NF7776_low_20
Description: NF7776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7776_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 23 - 196
Target Start/End: Complemental strand, 30418835 - 30418662
Alignment:
| Q |
23 |
tggtagagatgagtgatggtttacttttgttgcacggaaatggtgaatttgtggtggggaggaagatggttgaagataaggggtcatggaatttgaatat |
122 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
30418835 |
tggtagagatgagtggtggtttacttttgttgcacggaaatggtgaatttgtggtggggaggaagatgattaaagataaggggtcatggaatttgaatat |
30418736 |
T |
|
| Q |
123 |
ttaggatagggagtttttaaaaggtggcagaacaacttgaaattttcagattttgatgaagaaacggtggctgg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
30418735 |
gtaggatagggagtttttaaaaggtggcagaacaacttgacattttcagattttgatgaagagacggtggctgg |
30418662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University