View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_high_31 (Length: 263)
Name: NF7777_high_31
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_high_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 248
Target Start/End: Complemental strand, 38194770 - 38194527
Alignment:
| Q |
5 |
gattgacaacatatatctcttggtaatgtggtttacacgattttgggaaagtaaatttttatagatgcatcttagacaacccgatatcgtttgtgccaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38194770 |
gattgacaacatatatctcttggtaatgtggtttacacgattttgggaaagtaaatttttatagatgcatcttagacaacccgatatcgtttgtgccaag |
38194671 |
T |
|
| Q |
105 |
ttgatctatcatagataatgtaaaggtggctatcgaaattgtgcatcgagcgaagttcaaagttagaagtaaagtgggagatgtggctctctaaagcttc |
204 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38194670 |
ttgatctatcatagataatgtaagggtggctatcgaaattgtgcatcgagcgaagttcaaagttagaagtaaagtgggagatgtggctctctaaagcttc |
38194571 |
T |
|
| Q |
205 |
atattagtaaagcatataataaaattgattggagttatcttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38194570 |
atattagtaaagcatataataaaattgattggagttatcttttt |
38194527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University