View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_high_33 (Length: 244)
Name: NF7777_high_33
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 28 - 228
Target Start/End: Original strand, 31934544 - 31934744
Alignment:
| Q |
28 |
taaaaagaagttaagaaaataagatttattcataacaaagaagaaattaagaccagttcaatctgctattcaaaattcacggataactagtgaaacgaat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31934544 |
taaaaagaagttaagaaaataagatttattcttaacaaagaagaaattaagaccagtttaatctgctattcaaaattcaccgataactagtcaaacgaat |
31934643 |
T |
|
| Q |
128 |
tttatattttagattctctcctttcaatcaagtatctttgatccttctaaaatgtgtctatctcttgatattctttgtctctcttgatcatttttattta |
227 |
Q |
| |
|
|| | ||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
31934644 |
ttcacatttttgattctctcctttcaatcaagtatctctgatccttctaaaatgtatctatctcttgatattctttgtctctcttgttcatctttattta |
31934743 |
T |
|
| Q |
228 |
a |
228 |
Q |
| |
|
| |
|
|
| T |
31934744 |
a |
31934744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University