View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_low_22 (Length: 345)
Name: NF7777_low_22
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 19 - 337
Target Start/End: Original strand, 53426304 - 53426622
Alignment:
| Q |
19 |
gtttcgcacaatcctttgaaccgatggatgtttgataatgcagaattgtgaagcgctccagatacgttcaaccaacgcagaatcttatatcagatctcca |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53426304 |
gtttcacacaatcctttgaaccgatggatgtttgataatgcagaattgtgaagcgctccagatacgttcaaccaactcagaatcttatatcagatctcca |
53426403 |
T |
|
| Q |
119 |
tgtttaagttgcactcgaagaaaatattgaagcactttctctcagaccacacccataagagcattctgtttatgcatcatttagtacttctctctgaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53426404 |
tgtttaagttgcactcgaagaaaatattgaagcactttctctcagaccacacccataagagcattctgtttatgcatcatttagtacttctctctgaata |
53426503 |
T |
|
| Q |
219 |
agttatccttagtcataatcatattttgaaataaccgccacgccaacactgccaccttcaattggcatttcaatatcaatttcacatgatatatcctcct |
318 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53426504 |
aattatccttagtcataatcatattttgaaataaccgccacgccaacactgccaccttcaattggcatttcaatatcaatttcacatgatatatcctcct |
53426603 |
T |
|
| Q |
319 |
cattacattaagaataatg |
337 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
53426604 |
cattacattaagaagaatg |
53426622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University