View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_low_30 (Length: 306)
Name: NF7777_low_30
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 29671655 - 29671930
Alignment:
| Q |
18 |
cattccagcttccaaattcacttgttcagattctttgattataggtcttctagttgatttccctgtcttcaaattcaaccgaatttcagacaaaacactc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671655 |
cattccagcttccaaattcacttgttcagattctttgattataggtcttctagttgatttccctgtcttcaaattcaaccgaatttcagacaaaacactc |
29671754 |
T |
 |
| Q |
118 |
tccaaattctcttcacattcattgaatatcgaatcagccggtgtcatacacgatccaatcaccacaacttcatcattttcaggctcttcccacgcattcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671755 |
tccaaattctcttcacattcattgaatatcgaatcagccggtgtcatacatgatccaatcaccacaacttcatcattttcaggctcttcccacgcattcc |
29671854 |
T |
 |
| Q |
218 |
acagatgaaaacagaaacactctggtgcatcaatccaaatcatctcagaagaatcttcagcattctttgataaaac |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29671855 |
acagatgaaaacagaaacactctggtgcatcaatccaaatcatctcagaagaatcttcagcattcttggataaaac |
29671930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University