View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_low_32 (Length: 290)
Name: NF7777_low_32
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 21476474 - 21476248
Alignment:
| Q |
1 |
tttacaaccaagtacgataacaataaactctccctcactgaaagacaccgatcctgaactatggctttgcctcgatgccgtcgtgttacaatggatattc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||| | |
|
|
| T |
21476474 |
tttacaaccaagtatgataacaataaactctccctcactgaaagacaccgatcctgaactctggcttcgcctcaatgccgtcgtgttacaatggatatac |
21476375 |
T |
|
| Q |
101 |
ggcacgatttctaatgaccttctcaataccatcattgaacatgattcaagggcggaacttacttggaataggtttgtttgacatcttctatgacaacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21476374 |
ggcacgatttctaatgaccttctcaataccatcattgaacatgattcaagggtggaacttgcttggaatagg-ttgtttgacatcttctatgacaacaaa |
21476276 |
T |
|
| Q |
201 |
agttctagggctctttaccttgaacaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
21476275 |
agttctagggctctttaccttgaacaag |
21476248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 190
Target Start/End: Complemental strand, 21476233 - 21476203
Alignment:
| Q |
160 |
tacttggaataggtttgtttgacatcttcta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21476233 |
tacttggaataggtttgtttgacatcttcta |
21476203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University