View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_low_36 (Length: 266)
Name: NF7777_low_36
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 47862251 - 47862511
Alignment:
| Q |
1 |
aacaaaagcatatggctggtttaatctt-gacgcatattatgaacgttgagtgagatttcattcagttatacaacactaatgttttgtgtaccctattat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47862251 |
aacaaaagcatatggctggtttaatctttgacgcatattatgaacgttgagtgagatttcattcagttatacaacactaatgttttgtgtaccttattat |
47862350 |
T |
 |
| Q |
100 |
tctgacacattcatgctagttatttacacgtgtctggttcaagagaaagtgacgcgagagaggtttatgtgagaattggaacacttcttttgttcgtaag |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47862351 |
tctgacacattcatgctagttgtttacacgtgtctggttcaagagaaagtgacgcgagagaggtttatgtgagaattggaacacttcttttgttcgtaag |
47862450 |
T |
 |
| Q |
200 |
atcagtgaaataaggaagagaggttgacacgtgtggggcccatggttttttatattcttcg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47862451 |
atcagtgaaataaggaagagaggttgacacgtgtggggcccatggttttttattttcttcg |
47862511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University