View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7777_low_44 (Length: 242)
Name: NF7777_low_44
Description: NF7777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7777_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 224
Target Start/End: Original strand, 32398868 - 32399085
Alignment:
| Q |
7 |
tttggtgttctaggagatcaaagaatgtatggatgaagaagactgggttaggttttggaaatgaacaacaaaatgtagcaataaatttgggttattgcaa |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32398868 |
tttggggttctaggagatcaaagaatgtatggatgaagaagactgggttaggttttggaaatgaacaacaaaatgtagcaataaatttgggttattgcaa |
32398967 |
T |
 |
| Q |
107 |
aaccaacatagatctgatataaaaaataagttcaccaatgagttggtttcagactatacgaatgttagtgagatgttgaggggtgggaggcgaatttagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32398968 |
aaccaacatagatctgatataaaaaataagttcaccaatgagttggtttcagactatacgaatgttagtgagatgttgaggggtgggaggcgaatttagg |
32399067 |
T |
 |
| Q |
207 |
agctgttgttggtgatgt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32399068 |
agctgttgttggtgatgt |
32399085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University